Query (optional)   in Class  

GrainGenes Sequence Report: Ta.13208.1.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.13208.1.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE590506
[ Show all 17 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE590506
BF292836
BF483595
BE418533
BG604763
DNA
tttacatttggttgaaatggttcatggcaaaagattaaatgcacaaaagt
tttcagttggagggactccaaggaaagtgctataccacagcgatagtaga
acactgttggttatgagaactggtttatctggtgcatcatgttcttcaga
tattgtccaaatagatcctaataatgggatcttgctttcccgattcaagt
gtgaacttggtgaaactgcaaaatgcatccagattgngaaaataggaagt
gagcaagtgttaattgttgggacaagtaaatctactgaccggccnatgat
gccaaatggcgaagcagaaagtatcaaaggacgcctaattgttctaagnt
tggatactcttggaagtcctcatgagtgcagttcatttattccgacttct
aatttgagttcctcttctcatacgggctcattccctgaaattgttggatn
nncnnntnnngatttctctagcaacagcatgtgcagcagtcctgatgata
tttgctacaatcagattcaatttgaacaaatagcaggacacctgagatca
ctgactcatgttaccttcactggtgcagttcttgctgtatatccatatct
agatcgatatgtgttggcagcagctggtaatacgctttctgtatttggtt
ttgtgaatgaaaatcctcatcgtatgaagaagtatgccgtgagtagaacn
cgatttactattacttgtttgaagacatatggatcacagattgcagcggg
cgattgtcgtgatggtgttctcttctgttcttatcacgagaatcttagga
agttggaacttatttatgctgatcctgctcaacgattggtgggtgantgt
tgtcctcttagactgtgaaactgctgttgtgtcagatcgtcgtggtagca
tatctgtattatcctgccctgnactggaagtttctgaaagtccagaaaag
aacttagctgtacaatgttcattttttatgggcgaaatagctatgagcan
cnannangctgcatttaagtatcggctccctattggtgatgagacagacc
cagtgttggaatcagcttanaactgcgttgtggcgagtactttgctgggg
agtgtntttgttatgattccnctcaccagtgaggagcatcaactgttgca
agatgtccaagaaagactttcacttcacccgttgactgctccaatcttgg
gaaatgaccatgcagagtttcgtcgacgtggtatcccgtcgggagtgcct
tcaattctggatggtgacatgctggtgcaattcttagagctcaccagtga
gcaacagcaaactgtncttgangatggntcttcagtaaaggcaccacgca
ggtctatctcagttttccaggtcatgcgaatgttggagcgggtccactat
gcgctgaactgaggttttctgcaaccaacttggttcactcataccgctgg
nnnnnnngtactgcagataataccctgccgtgacctgcagataataccgc
cggaccaaggtcgtacacatttggtgctgaggtgatgttaagagtgtaat
agtcaataccctgccgtgacgtgcgtctccctatttataatactccctcc
gtccgaaaatacttgtcgcggaaatggatatagatggatgcatctaaaac
taaaatgcgtctagatacatccattcccccgacaagtatttccggnacgg
agggagtactatatagacgttgtaaagtaccgaagtctttttgtacataa
aattnggcaaaagaacatcctcagaattaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search