Query (optional)   in Class  

GrainGenes Sequence Report: Ta.14467.2.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.14467.2.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE424711
[ Show all 35 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
agtatctctaacgttggcttgtgctcatctaacttgaaattgttgatata
tccatttaagcttattgggttatgcaaccctcttgcactcagaaaatcta
gtttcctttgataatatctgatcgtttacattaattgaaaataatcagaa
cttagcgagcttgatgtctcagaacttanagtttgcatgaaatgcaacct
ggattacttgctcgcagaaacttcagctgtgctaaatgtaattgttttca
ttttgcagaaaccctgccgctggtttccctgctttggctagtgagcatcg
tgtgcctattcctaaggcccggtctacccaaccgaagcctggcggctcca
aggagagccgaaagaggtctcgcaatggtagccggaaagccaagcagtga
tcaaccangagaccttggnagcttctaccccatggaaggcgctggagggg
cacaagggagaggatcaagctagatgctccgccattgcgtgcagctgccg
cttgctagactagtgccagcttattcgcaagtttccagtatgtagtgtag
ttagcaatgaatgtctaaatatgtgttctcttgctgccaccgtggcttta
tccatgactatcttctgctctctctgttcgcgttgttttatgatcttcta
atcagatgctagttttgaaannnnnnnttctgtgttactttatgtcgggc
actctgtgtccatctctctgggtttatgtcaaattcagaccatagaaagt
tcacgagtgaagtcacaagtgaaaggccactaaatcttcagtgttcaaaa
ttacagtaacggcaagcagctagtacaagtgcagtactgtagtgttttcc
tactttnggggttaggaaaatctcctatatggttcatttngtgtactcat
ttngtnnatctngcaagaaaaatacaataacgacattncgttgatcacca
agaaa
BLAST
BLAST Search