Query (optional)   in Class  

GrainGenes Sequence Report: Ta.1483.1.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.1483.1.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE405854
[ Show all 41 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE405854
DNA
ccacgcgtccgctgtaaagcatagannnngncnngnnggtcgcggcagcn
ctctcaactccnncgcnttccnccgattccggcgatccanacngaatccg
gccgattcgnnnnnnnnnnaggcggactgggggttcggnttcggggcngn
gaagaggagagnagggggagatggaccaggtnctgaacaaggtggggagc
tactggttcagcaagagggccagcaaggagatcgactccatcggcgacga
cctcaactcngtctcttccagtattggcgggggagctaaatggatggtga
acaagatcaaagggaagctgcagaaagcattaccagatcttctcaaagaa
tatganatgccagcaggcctcttcccacgggacacaactaattacgagtt
caatgaagagacaaagaagctgacagtgtacatcccgtcagcttgtgacg
tcgggtacaaggactcatcggtggtgcggttcttcacctgtgtgaccggc
tacctcgagaagggaaagctttcnganatngagggcatgaagaccaaggt
gcttgtatggaccaaggtgacctccatcaagaccgagggctcaaaggtcc
atttcactgcnggcatgaagaagacccgcagccgcgatgcgtatgaggtt
gtcagagatggcatcatcatagacaagttctagagcatacctgtacctgg
gctgacaggtgcaatgtaattacttagatatgctacattgaaatctgttg
tgctatcggatcggcctattaaccaantgtgttgntgaaaactnccatcc
angactttttctatatcttgacaannnnnnnnnnnnnnnnnnnnnnnnnn
nntcnnncaccagacnnnannnnnnnncnggaccggggcgccatgtttat
ccagttttagttttgaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search