Query (optional)   in Class  

GrainGenes Sequence Report: Ta.199.1.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.199.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AF030421
[ Show all 42 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE443203
BE488501
BF292170
DNA
gcggatctacagtctccagagctcccgggaaggaaaatatccgtgaaaga
aagagactgatgagccaaagcgtgacgactgcacgcctccgctcacctaa
ccaaacccctccttaaacaaagcctcttcgtctctcacatcacncccnct
nnctncttatcncctccnacctcactcccnctcctcncctctctcccccc
ncnctgccgccatggcccaagcttgggccttcctcctcccggtnctcgtc
ntcggctcctacgtnaccagcctcttcntccccanctatatanccggccc
cctctgcggcggcgatggnggaggcagatccttgttcctctgcgcgcagg
ctcccaaggaccaggacccntctcctgcnnncagcaccatgtacaagacc
gccttccacttccagcccgccaagaactggatgaacgatccatctggacc
aatgtacttcaatggcntctaccatgaattctaccagtanaacctnaacg
gncccatttttggtgacatagtttggggccattcggtttcaacagacctn
gtcaactggatcgggcttgaacccgcgntagtgcggganancccnagtga
catagacggntgctggaccggctcngtcaccattctgccnggtggtaaac
cnntcatcatatacactggtggngacanagatcaanatnaggcacaaaac
atcgcgttncccaaaaaccggtctgacccntacctgagggaatggatcaa
agcanccaataacccggtgctccgaccggacgaaccagggatgaactcna
tcgagttcagggatccgacaaccggttggatcggaccggacggactgtgg
aggatggcagttggtggtgagctgaacggctacagtgctgcncttttgta
caagagtgaagactttctgaantggacaaaagttgatcacccactgtatt
cacataatggatccaatatgtgggagtgtccggatttctttgcggtattg
ccgggcaataangctggactggatctgtccgcagcgatnccacaaggcgc
caagcatgccctcaaaatgagcgtggattcagttgacaagtacatgatcg
gggtgnatgatctccaacgtgatgcctttgtgccagataatgtcgtagat
gaccgtcggntgtggctgagaatagattatggcactttctatgcttcaaa
atcattctttgactcgaacaagaacaggaggatcatatggggttggtcta
gggagacagatagtccttcagatgaccttgaaaaaggttgggcaggactc
catacaatccccaggaccatttggttagccgncnatggcaagcagttgtt
acaatggccagttgaggagattgagtcccttcgaacaaatgaaatcagcc
atcaaggaatagagctcaacaagggagatctatttgagatcaaggaagtt
gacgcttttcaggctgatgtagagatagntttngagctggcgtccatcga
tgacgccgatccttttgatccttcctggcttttggaccccgagaagcatt
gtggngaagcgggtgcatcagttcctggtggtataggtccatttggactt
gtcattctggcctccgacaacatggacgagcacactgaggtgtatttcag
agtctacaagtcacaggaaaagtacatggtactcatgtgctctgatctaa
gaaggtcttccctgagaccagatctggagaaaccagcctatggaggcttc
tttgaatttgatcttgaaaaggaaaggaagatatcactcagaactctgat
tgaccggtcggcngtggagagcttcggnggcggtggcagggtttgcatca
catccagagtttatccggcggtgctngccgacgtcggcagngcccacatt
tacgcnttcaacaatggaagtgccacggtcagggtgccacagctcagcgc
atggaccatgaggaaggcacaagtgaatgtggagaagggttggagtgcta
tttaaaanagaggancaaattgattttctcgattcttttactgtcattca
tnagcattgcctggcagaaataaggacattcagcnggaaannaaatagcc
tatcatttctttgntctctagtattcatatattgtannngttactactta
gtangcccttcccatctcagttacttgtatcaatttttanngaaacgcac
actagtnntgaaattcacgggatgagtacntnagtcacacanannaannn
nnnnaaangttttaaagnnnnnannagantnngtgagcnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BLAST
BLAST Search