Query (optional)   in Class  

GrainGenes Sequence Report: Ta.21235.2.A1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.21235.2.A1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
CD454811
[ Show all 6 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
gccatcaagaccaccaaccgccgcgtcaacgccctcgaaaacgtcgtcaa
gcccaggctcgagaacaccatcacctacatcaagggcgagctcgacgagc
tcgagcgcgaggacttcttccggctcaagaagatccagggctacaagagg
agggaggtcgagcgccagatggccgccgccaagctcttcgccgaggagca
gctcgccgaggatctcgccctcaagaggggaacctccatgggggccacga
ccaacatacttgttggcggcggcgacaaggacgaagacatcatcttctga
tnccccacccctactgtccaattgttcaatcgcggtggaaacaataagtt
ctggtgctggagctccaggattgaatctgtttatatagagtggcggaggt
ttttgtttcaggctgtgtgcagcctaaaattatggccatccaagacccaa
aataatctctctctgtactttgggaaccaaacaatgatggtgaaactagt
ggctatgtgcagtagtaaaaattcttttgtaccgtatttcgttcccctgc
acgctcagttttagttgcatatttattatccagacgttgtgcacctgtat
tttggcacgcttcgctgtgaaccagctctgtannnnnnannctggnctgt
ntctttctntcnnnnngnnngtatctctttggcagctactgtattccttt
ctcagcttttcttggaggaattagttgttgcgttacggcttggaaccaaa
taaacacaaaattctgaaaaaaaaaaaa
BLAST
BLAST Search