Query (optional)   in Class  

GrainGenes Sequence Report: Ta.24114.1.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.24114.1.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE399237
[ Show all 107 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE399996
[ Show all 6 ]
DNA
gngagnnntttannnccntnnnnttttgattccgnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnanngcgcatcatttaag
ccaagcaagcagtgctcaatacaaatccaccatgaagacctttctcatcc
ttgccctccttgctattgtggcgaccaccgccacaactgcagttagagtt
ccagtgccacaattgcagctacaaaatccatctcagcaacagccacaaga
gcaagttccattggtacaagaacaacaatttccagggcagcaacaaccat
ttccaccacaacagccatatccgcagccgcaaccatttccatcacaacaa
ccatatctgcagctgcaaccatttccacagccgnncaactaccatatccg
cagccgcaaccatttcgaccacaacaaccatatccacagccgcaaccaca
gtattcgcaaccacaacaaccaatttcgcagcagcagcagcagcagcagc
aacaacaacaacaacaacaacaannnnnnnnnnnnnnnnnnnnnnnnatc
ctacaacaaattttgcaacaacaactgattccatgcagggatgttgtatt
gcaacaacacaacatagcgcatggaagctcacaagttttgcaangaaang
tacttaccagctggtgcaacaattgtgttgtcagcagctgtggcagatcc
ccgagcagtcgcggtgccaagccatccacaatgttgttcatgctattatt
ctgcatcannancaacanccaccnnnnnaccaccaacaacaacaacaaca
acaacaacaacaaccgttgagccaagtctccttccaacagcctcagcaac
aatatccatcaggccagggcttcttnccaaccatctcagcaaaacccaca
ggcccagggctctttccagcctcaacaactgccccagtttgaggcaaata
aggaacctagcgctacagacgctacctgcaatgtgcaatgtgtatatccc
tccatattgcaccattgctccatttggcatcttcggtactaactgagaag
agaagaactctagtagtagatatatgatacaccgttttcttagtccatgg
tttggtcgttgtagcggtgaaaaaaataaagtgacatgcactatcatgta
agaacctgaactatactagttcaaannnngnnnaanaaaannnannnncn
nnnnnnnnttntnnananannannnnnngttnnagttccaaannnccgtc
tncncccttntcagnagttttttcccccgngggggggggcccggtaccca
aattccnccctaatagggaggtcgntagtaccccccccccacctgggccg
tt
BLAST
BLAST Search