Query (optional)   in Class  

GrainGenes Sequence Report: Ta.24959.1.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.24959.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE422596
[ Show all 263 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE590480
BG263028
DNA
caccgccagtgcgattagggcctatccaggtnagatagtatnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnncncnnnncnnnncttngctccgcnccccnncncnctcncc
tncatcctcctccggtttctgatcgcgaccatgggaacccgcggnctcgc
cntgctgctcctngcggcngtgctgctgcagnccctcctcccggcgtcnn
angcggagggcctggtgcggatcgcgctgaagaagcncnncnatcgaccg
gaacagccgcgtcgccnngagcctctccgnccgcgaggaggngcncctcc
tcngcgncggcgncgccaacaccctncgctccgaggaggagggcgacatc
gtgtccctcaagaactacatgaacgcgcagtacttcggggagatcggcgt
cggcacgccgccncagaagttcaccgtcatcttcgacaccggcagctcca
acctctgggtgccctccgccaagtgctacttctcgattgcgtgctacctc
cacgcacgctacaaggccggggcgtccagcacctacaagaagaatggaaa
gcctgctgccattcagtacggcactggttcaattgctggatatttcagng
aggatagtgttacagtgggtgatctngttgtgaaagatcaggagttcatt
gangctacaaaggagccaggtgttactttcttggttgcaaagttcgatgg
tattcttgggcttgggtttaaggaaatatctgttggcaaagcagtncctg
tgtggtataatatggtagagcaaggtctnatcagtgatcctgttttctcn
nttctggttgaaccgacatgctgatgatgaaggagagggtggtganatta
tttttggaggaatggatccnaaacactacgtgggtgancacacatatgtc
ccagtcacccagaagggatattggcagtttgacatgggtgatgtcctggt
tggagggaagtccacaggattctgtgctggcggttgtgcngcaattgctg
attctggaacttcantgcttgctggncccacggccatcattactgaaatt
aacgagaagattggtgcngctggggtagtcagccaagagtgcaaaacaat
tgtttctcagtatggacaacagatcctcgacctgttgctagcagagacac
agcccaaaaagntctgctcccaggttggtctgtgcacctttgatgggact
cgtggtgttagtgctggaattcggangcgtggtngatgatgagcctgtga
aatcgaatggcctccntaccgatcccatgtgcagtgcctgtgagatggct
gttgtgtggatgcagaaccaacttgcacagaacaagacccaggatctcat
actngattacgttaaccagctgtgcaaccgtctnccnagncccnatggga
gantcagcngtggactgtgcnagccttggatccatgcctgacattgagtt
caccattngtggcaagaagtttgcgctgaaaccagaagagtatatcctga
aggntngnngaaggagcngctgcccagtgcatcagtggattcacagccat
ggannncnncccncctccncgnggtcctctctggatcctgggagacgtnt
tcatgggcccctaccacaccgtcttcgactacggcaagctgcgngtcggn
ttcgccaaggcggcctgaangggtgntcgagnngagcgccccancngngg
aggcgaacacttgcgccggganagagcttagcttttttactcngaatttg
accggngntgtgtgtnngtatatatnngctacatgctgcttttcaaanga
ccctgacatgacnaagggtngttcctaagatggnnnagactgtttnnngn
natgttnnnnnnngnnnnnngntnnnnaattantatgtgataaacaacgt
ttnccttctannannaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
annnnnnnnnnnngnnnnannnnnnnnnnnnngnnngnnnnnnancnnng
gnnnnntg
BLAST
BLAST Search