Query (optional)   in Class  

GrainGenes Sequence Report: Ta.25124.2.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.25124.2.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE423193
[ Show all 180 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE517853
BE423193
BE424723
DNA
gacaacccacgcgtgnngcnnnnnnnnnnnnnnganngnnacnnnnanng
anngannnnnnnnnnnnnnnnnnnnnnnnnnnctncncccaggtaaagga
aagnttcgcccatggctccgtcgcagcccaagtcgggcctcttcgtnggc
atcaacaagggccacgtcgtcaccaagcgcgagctgccgccgcgcccgtc
cgaccgcaaggggaaaggtaccaagagggtgcatttcgtcaggaacttga
tcagggaggtcgctgggtttgctccgtatgagaagcgtatcactgagctt
ctcaaggttggcaaggacaagcgtgccctgaaggtggcgaagcgaaagtt
gggtacccacaagagggcgaagaagaagagagaggagatgtccagtgtcc
tcaggaagatgagatctgctggaactggaacnganaagaagaaatagagc
atcccaggctcantnnangttgatggcaatcttctgttctggtgtccagt
ttttactgcatgtagaacctactagacntgaaactgttatccgcnagcta
aacattatgctatgttgaacctcctgtcttgtgagatttttgatctaact
tgcaatgcatcgtttgccaccctatttctgantttgcttcnannnnnnnn
nnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnctnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnngccgggagctcggcgacgcgttggaagcatg
gct
BLAST
BLAST Search