Query (optional)   in Class  

GrainGenes Sequence Report: Ta.2583.1.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.2583.1.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE446628
[ Show all 54 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE446628
BE637935
BF429122
BG275060
DNA
ccaccgctagtgcgatataggcctatcccaggtgacttagattnnnnnnn
nnnnnnnnnnnnnnnnnccacgcgtccgaaatnctgcaactgcaagctcn
nnnctccnccangcaacctgagcgagacctgcaagaaacaaacaccgggc
ggcaggnnggnnnnnnnnatcgatcttgggaaccagcggaggngatggcg
gccaagggggcgaccgagntggaggtggncggcgacggcgtcgccgtcat
caccatctgcaacccgccngtcaactccctctccatcgatgtactcctaa
gcttaaaggaaagctatgaagaagctctncagagganggatgtcaaagct
attgttgttacagggaaaggaggnaaattttctggaggattngatattag
ttcctttggngatcttcacagtggaaaaattgagcagccaaaggttggtt
acatatcaatagacattctcactgaacttctggaaggngcaacaaagcca
tcngtggctgcaattgatggtctttgtcttggcggaggattagaagtttc
catggcatgccatgcacgtatttcaactcccactgctcaattaggtcttc
cagaacttcaacttggnatcattccaggatttggaggaacacagcgactc
ccacgtcttgttggnctgacaaagtcactngaaatgatgttgctatccaa
gccaattaagggncgaagaggcacaccaactgggtcttgttgattccnta
gtttctcctaatgatttggtgaatactgctcgtcgttgggctttggatat
ctgtgagctcanaaagccatggatcaaaagcctttacaagaccgacaaac
tggaaccccttggngaggntagggagattctcaagtttgcaagggctcaa
gctcgaaagcaggctgcaaatcttgaacacccacttatttgtattgatgt
cattgaagaaggtatagtttcaggacctcgagctgggctctggaaggaag
caaacgcattccagggccttcttttctcagatacatgtaaaagcttactt
catgtattcttctctcagcgtgcaacatcaanggttcctggtgctacaga
cttgggtttgatgcctaggaaaataacgaaagtcgccattctaggtggtg
ggcttatgggttctggaattgctaccgcaatgatactnagtaactatcct
gtgctgctgaaagaagtaaatgagaaatttntgantgctggaattgacag
gatcaaagccaatttgcagagtcgtgtgaggaaaggaaaaatgacagagg
agagatacgggaaggctttatctcttctcagtggtgcccttggttatgaa
aagttcaaagaagtggacttagttatcgaggctgttattgagaatgtgaa
gttgaagcagcaaatatttgctgacttggagaagtactgcccttcccatt
gcatccttgctaccaacacatctacgattgatcttaatctaattggagag
aaaacaaagtcccaagaccgtattgttggngcacacttctttagtcctgc
gcatgtgatgccactcntggaaatagttcgtacccagcacacntcagcac
aggttgttgttgacttgctggatgtcgggaagaggatcaagaagacacca
atagtggttgggaattgtactggttttgcngtcaacaggatgttctttcc
ttacacccagtcagcactcctgtttgttgattatggnatggatgtttaca
agatngatcgtgcatgtaccaaatttggaatgcccatgggtccattcagg
cttgcagatcttgttggttttggtgttgctgnggctactggtatgcagta
ccttgaaaatttcccngagagagtctacaagtccatgntaatccctatta
tgatggangacaaaagnncaggcgaagccagtcggaagggattttacaag
tacgaggatannnaggaaggcaactcctgatcctgaaattatgacgtata
ttcagaaatctaggagcatggcaggagtcactccagangctgagttgatg
aagctaagtgacaaggacatagtngagatggtgttcttcccngtcataaa
cgangcatgccgtgtccttgatgagggcattgcngtcaaggcgtcggatc
ttgacatcgcctcaatctttggcatgggnttcccaccttacaggggaggg
gtcatgntatggggngattccatcggcgcaaaatacatccacggcaagtt
gncnggagtgggcgaagcggtacggcagcttcttcgagccttgctcctac
ctngccgaaagagcngcaaangggattcctctgagtgcaccagcagcaag
tcaagtcaagncccggctataggtgatggtaggnctggtanttctgtcag
ctgaaggaaattatgncaccgagtaataatgcgcgatgaaggnnnnnnnn
tggtgattagtggaaggggctgaataannataacaacacgtgagctgtat
attnggaagcaaaggaaaccgtaactnattgcggttggacccttgnaagn
gntttatgtaatatgngcaatgattnttanataatattngcaaatatgct
ctgtcaattcttttgttacacnccgaannnnnnnnnnaanagngntgaat
gtntaaacctgaatttntgaaanaannnnnnnnnaaaaaaaaaaaaaaaa
aaannnnct
BLAST
BLAST Search