Query (optional)   in Class  

GrainGenes Sequence Report: Ta.27399.1.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.27399.1.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL817757
[ Show all 44 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
gggtgggngggctgcanccacncgnccngacgcatcctccactcttcacn
ncaccntctagctagctcttgttagntcgancggnaatggcgtccaccaa
ggctctcttcgtgctcgccgttctcctcgcgtcggccgtcctcctcgccg
ccgcggcctccgagcaaactcatgacaaggaggggaaggtggncaccaac
ggtgccggcgtccaggacggctggggtggcggcggccgnggcggagggta
cccgggccgcgggggcggcggctacgggccntgnggncnggtggggctgc
tgccgccgtgggtaccacggcgactgcatccgntgctgcngggccgccaa
cgacgtcccggaggccatggaccgcactgaggtgcacaactagctagctn
nnnngctggctatggcttggctagcaagcaggannccatgatcnnnntgg
aagctagcttcttccagggtactnnnngantaaaataaatctccggttta
ngttcatgtgatctntgtatgtgcgcggatgaacgtatgtanctacgtac
nnacgtncgtnagtcctcttnnnntgnttngnnnnannnntaatnagaaa
ntgtgatgcgtgttnagtttgnnanannnnnnnnnnnnnnnnnnnntntn
gttgtgtttccgatcgatcgcgtggantgnatctccttcatgtttacgcg
gngattgccgaaannannnnnnnannnntacnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnn
BLAST
BLAST Search