Query (optional)   in Class  

GrainGenes Sequence Report: Ta.28378.2.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.28378.2.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL821471
[ Show all 9 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE443420
BF429344
BE399288
BE424229
DNA
cnncagctngcagcacggcctancatctccggtgaggcaggcaagcaaga
gcagagagtgatnngcgtccccccgtcccatggccgccgcgcccgccgtc
ctcctcctcgtcctgctcctcgtcgccacagagatngggacgatgaagac
ggcggaggcccggacgtgccagtcgcagagccacaagttcaagggcgcct
gcttcagcgacaccaactgcgccagcgtgtgccgcaccgagaagttcccc
cgcggccagtgcaacacgcactacgtcgagcgcaagtgctactgcgagcg
ggactgctgagcttccgcctccgtcggcgcctgttcgttcgtgtcttccg
tgccggtcgatcttaggattgaccagaaataaaaggagctccatcgatgt
tgcctcttcatctgcatgcatgcacgcatgcatccatgcatgtggtttgg
gtgaagatcggtcgtggctccggcgtgtttgcggcttcaattagtttgtg
cggttaatgatgcatgttgcttctctctgtgtctctgtgttgtgttggat
tcagtcacttagttggctcgtctcttttttcttttcaaaaggatcagatc
tattacgttcannnnannnnnnaannnnannnnnnnnnnngccg
BLAST
BLAST Search