Query (optional)   in Class  

GrainGenes Sequence Report: Ta.30803.1.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.30803.1.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
[ Hide all but 1 of 186 ]
AL819229
AL820362
AL829015
AL829915
AL830217
AL830872
BE414128
BE423832
BE492337
BE516058
BF473526
BG312657
BG314239
BG607525
BG607910
BI478999
BJ210250
BJ212482
BJ213832
BJ217432
BJ219945
BJ221393
BJ223556
BJ223578
BJ223668
BJ223991
BJ224107
BJ224901
BJ225333
BJ226666
BJ226744
BJ226995
BJ227933
BJ228070
BJ228269
BJ228295
BJ228411
BJ228716
BJ228813
BJ229687
BJ229972
BJ229989
BJ230707
BJ231587
BJ231672
BJ237673
BJ243252
BJ244586
BJ249295
BJ250424
BJ258267
BJ261928
BJ262145
BJ262330
BJ263865
BJ267065
BJ267824
BJ268830
BJ268869
BJ269440
BJ270062
BJ270316
BJ271524
BJ271741
BJ272180
BJ272761
BJ273730
BJ273768
BJ274400
BJ275058
BJ275251
BJ275318
BJ275413
BJ276745
BJ278680
BJ283734
BJ288297
BJ288967
BJ289020
BJ289401
BJ289666
BJ289669
BJ289927
BJ290484
BJ292867
BJ293730
BJ293735
BJ294711
BJ295256
BJ295304
BJ295727
BJ295994
BJ295997
BJ296256
BJ297061
BJ297419
BJ297653
BJ298461
BJ299274
BJ300185
BJ300191
BJ302233
BJ304317
BJ308058
BJ310268
BJ310610
BJ314480
BJ317166
BJ317831
BJ319960
BJ322711
BQ295201
BQ578916
BQ606896
BQ744279
BQ800714
BQ801343
BQ803162
BQ803215
BQ803898
BQ805675
BQ902497
BQ902808
BQ903077
BU099646
BU100724
CA648961
CA671659
CA691923
CA703293
CA706402
CA707327
CA720569
CA730992
CD867593
CD867594
CD884987
CD887744
CD887745
CD888499
CD888500
CD892067
CD892914
CD892915
CD897188
CD903129
CD903170
CD903171
CD918064
CD920802
CD921858
CD925141
CD925628
CD925878
CD929731
CD929732
CD932623
CD935278
CD935306
CD935803
CD935968
CD936281
CD936414
CD937253
CK151747
CK151772
CK153594
CK155509
CK155548
CK155583
CK155674
CK155779
CK155800
CK164178
CK164445
CK166598
CK166662
CK166999
CK167317
CK167539
CK169195
CK169406
CK169480
CK212038
CK213029
CK215678
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
nnncagctnntnnnnnnnntnnnncccnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnncgnnnncncnnncnnnnnccnnnn
nnncnccnncagccaatcctccccancccaagctcgcagccatgcctccc
aagctcgacccgtcccagatcgtggaggtgtatgtccgcgtcaccggcgg
ggaggtcggcgctgcgtcgtccctggcccccaagatcggnccgctcggtc
tctccccaaagaagatcggagaagacatcgccaaggagacggccaaggac
tggaagggcctccgcgtcaccgtcaagctcaccgtncagaatcgccaggc
caaggtgtccgtcgtcccctccgccgcagccctcgtcatcaaggcgctca
aggagcccgagagggaccgcaagaaggtcaagaacatcaagcacancggc
aacatcagcctcgacgacgtcatcgagatcgccaagatcatgaaggtccg
ctccatggccaaggagatggccggcaccgtcaaggagatcctnggcacct
gcgtcagcgtcggctgcaccgtngacggcaaggaccccaaggatctgcag
acggagatcgacgacggcgaggtggagatccccgcttaagaaggcttggc
tttgggnaggttgttatgtgaggctgctgaagtagtttctcctatctaga
tgcttcctgatgcanttgagagaatggatgtgatntcttcacttgttcta
ctcntgcngaagaagaaacttttgtcatgctttantggttccattgtgag
actatttttnnactgnnnntnanngagtaccttncggaatcaatcaatgt
tattatggcagctagaatatcanannnnnannnnnnncannnnnnnnnnn
ngnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnn
nncgcataggctggta
BLAST
BLAST Search