Query (optional)   in Class  

GrainGenes Sequence Report: Ta.3571.1.S1_at

Sequence
Ta.3571.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
[ Hide all but 1 of 9 ]
BE516235
BJ212011
BJ213180
BJ219459
BJ220665
BJ232494
BJ234013
BJ238139
BJ239880
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
gggcgccgccgcgtcactcctcctccttcncaggcgctgcagcttnactc
ctcctcctccccaggcgccgcagcgtcactcctcctcctcctcaggcgcc
gcagcttcactcctcctccccaggcgccgccgcgtcaccgcttcttcgtt
cgccgcgctatctcctcccagtcgcccatggatatcacgcgtggcgccgc
cgcagctttctcgcggggtgccctttttgctgttcgctcccatgcgagga
tcggtttctatgggggtttgttcatggttgtgtcgtcggttgccgggaaa
gtcgtcgtacacagttttccgcaccttggagataggctaatgcggtgctc
caagtactgttcgctcgtcttttcttccataaccacgacatcggtggtag
ccagttccatcatccggtacaccatgcctgaccctgatatcatcttcgta
aaccctcttcctctgccgcctgccaggtttaatgccttggctgatccaga
tccggggttcaagcatgcttttggagagcgtctactctttattgagacac
ttgaccttaacaacataccttggttgatccatccttggattgatgctgat
gctcgtggagatatcatcaatattgatgtggaccaagctacttccccctt
tgaggcatttgaaatatggcagttcatatgccaattgccagaggcttggc
caagcttcttggcacgaaagcactgtcctatcttgatgtcaaaggtgaag
gagcatctcgatggccatctttgggcacctgtgttacaaggtgattggga
ttagatctacggcagtgagtatctagttttgtttgttaacgtatgaagca
gtcaagaaagaccttttttacattcctctttttgaaccaatggcaactgt
ttgccctaatggcgacttaagttatgattcgctctaatggcagattatgt
gaagaactgctgctgttgcagtataagttatgaagctctaatggcaatct
ngactatgtctggagtacngattctcctttttgtttatgggaacgcatat
gtgatgttatttttataagaaaccaattatttccatt
BLAST
BLAST Search