Query (optional)   in Class  

GrainGenes Sequence Report: Ta.39.3.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.39.3.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BQ167887
[ Show all 173 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE426655
BE637556
DNA
gcacgaggcgaaccatttaatgcacaaactcttgccagaagcaactgttg
ttgcagaagatgtttcaggcatgccagtgctttgtcggtcagttgatgaa
ggtggagtagggtttgactatcgcctggctatggctattcctgatagatg
gatcgactacttgaagaacaaagatgaccttgaatggtcaatgagtggaa
tagcacatactctgaccaacaggagatatacggaaaagtgcattgcatat
gctgagagccatgatcagtctattgttggcgacaagactatggcatttct
cttgatggacaaggaaatgtatactggcatgtcagacttgcagcctgctt
cgcctacaattgatcgtggaattgcacttcaaaagatgattcacttcatc
accatggcccttggaggtgatggctacttgaattttatgggtaatgagtt
tggccacccagaatggattgactttccaagagaaggcaacaactggagtt
atgataaatgcagacgccagtggagcctcgcagacattgatcacctacga
tacaagtacatgaacgcatttgatcaagcaatgaatgcgctcgacgacna
nnttttccttcctatcatcatcaaagcagattgtcagcgacatgaatgag
gaaaagaagattattgtatttgaacgtggagatctggtcttcgtcttcaa
ttttcatcccagtaaaacttatgatggttacaaagtcggatgtgacttgc
ctgggaagtacaaggtagctctggactctgatgcncnnnnnntnngnnnn
nnnnnagnnnnnncnnnanannnntnncnnnnngnnntnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnncnngnnncagaacccntagccgccgccga
cgccccaggtaagggagagagcccaccccccgctgccgccatgaagcgca
acccccgcgtcacgagctcccgccggaagtgccgcaaggcgcacttcacg
gcgccgtcctccgtccgccgcgtgctcatgtccgcggccctctcctccga
gctccgccacaaatataacgtccgctccatcccgatccgcaaggacgacg
aggtgcaggtcgtgcgcggcacctacaagggccgcgagggaaaggtggtg
caggtctaccgccgccgctgggtcatccacgtggagcggatcaccaggga
gaaggtcaatggatccacggtgaacgtcggcatccaccccagcaaggtga
tcgtcaccaagctcaagctcgacaaggaccgcaaggccctcctcgaccgc
aaggctcgcggccgcgctgctgacaaggccaagggaaagttcacggcgga
ggacgtcgccgccgccgctgggggcgccacggccaccggtgcctcgctcc
aggagatcgattaagcttgggatctgccggttgccatactgctcttgata
tcctagttttattaccatcaccagttctgttaggatatgctatctgaaga
ctgctttatnattcgtangatgntcgtggatgagcgtttncaaaccttta
atgtgcatcntntnatgggtctgnnccttggattttganannaagacttc
annatatgttnaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcnnn
nnnnnnnnnnnnctaactcgtatgganagntactaancgcacggtcgtgt
g
BLAST
BLAST Search