Query (optional)   in Class  

GrainGenes Sequence Report: Ta.6121.2.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.6121.2.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL817453
[ Show all 21 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE403957
BF474090
DNA
gnnnnnnnnncnnnnttagggtttctcccaggnnttttccccncgcngcc
gccgccgccgccaccccgctcctccggatcgccgccatggcagccgcagc
cgcnnncgccgccgaccaggctacgaatttgctgcagaagctatcccttg
atgccaagactgaagccatcgacgcnccggcggcgaaggagaaggcgtcc
ggagggctgggcggcaagctgaatggtgtggcggcnacncggaacccacg
ggcgnccgagcagtgggcaaatccacaggattacagcgatgcaagcatgt
attatggcgcctaccctgctgcttactattgcgcaggttggggtgattat
tccatgtacttgaatcaggatggagtggaaacacctaccgctggtgccta
tggtgacatgtactgctatcctcaatatgggcatgatggtcagatgtatg
ggtcacagcaatatcagtacccatcatcataccaccagccccagaatact
gccagtaagccacaatacaagtctaaaactgacaagctagccccntcaaa
ggatatttcctcnactgttgctgatccgctgcatgccgtagccagtgctc
ccaaagccactncaaacagcgttgatgaggtaaaaggtctgaagaagaca
tccacaccactgaacccnagtgggaacaatggtagttacctgaaccaaag
tagcagaccagcttatccatggtacggtggccaaatctaccagggaaaac
agcagaagccttctagtggcaatcctacttcaactgattcaaatcctaaa
agcaaggttcagtcgaagaatcagaatacncaacctcttcctcctctnat
gagtttacctaactcaccgntggcttcaatgtatgctgctaatggaatgt
acaacagcantgcctanggtggcttttggtatggatcccanttttatggg
ccaggaatgtatggtgggtggaataatctgtcggatggaaaatacaagcc
ccnangggaggacagcntatggatcgtatggattncccaatgaaaacttg
gatggtttgaatgagttgaagagaggaccncnggagtnganctctataat
aaccaacagggctttggacctgctgctgnnacagctgtcaaagcacagga
tgtttctgctactgatggntctaatgcagttgtgcaggatcagtacaacg
ggtctgacttagctgacacttangaaaatgccaaatnctttattattaag
tcgtacagcgaggatgatgttcacaagagcatcaagtacaatgtttgggc
tagcacacctnatggaaatnaaaagcttgacagtncttatctngaagcta
aatctgtcaattctcctgtattccttctcttctctgttaacaccagtggg
cagtttgttggtctcgcnnngntngttggccnggttgattttgacaagac
ggtggaacactggcagcaagacaagtggactggttgcttccctgtcaagt
ggcacattgtcaaggatattcccaacaacttgttaaagcatatcattctc
gagtataatgaaaacaaaccngtgacaaacagcagaganacacaggaggt
caagctcgagcaaggncnttcaggtgtngaagatttncaaggatcatgtc
tcnaaaacatccatcctggatgacttcagcttntatgataaccgtgagaa
gataatgcaagagaggaaatcacagcggcagcnncaactgaannngatca
cgagtccgaagntgctgcctactgttgacaacacngnaaaatgattccgg
caatgcgcaggaatcgcagaagcctgaagttaccggagagaacaaatctg
nggtggaagacaatgtggaggcggctgccgtgagtggcgttgccccgaaa
gatgctaaccccacagccgcaagcttggctgtcgcnaatggctgctgatt
tttttgtctgtngagttgtgagtaaggtnnnnnnnnnnnntnggnnnttt
ngnngnngnnngnnnngttcaactgttggaggcaatcagggttctgttgg
ggttctgtaggtgtttttgcagaaagtttgagggatatggttaggtttct
cttgag
BLAST
BLAST Search