Query (optional)   in Class  

GrainGenes Sequence Report: Ta.647.2.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.647.2.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BG314148
[ Show all 14 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BF202464
BM134371
DNA
taaagggacgacgcaccggcgggttcgcagccctagttttcgatctgatc
tttccccgatcttcgccgcccaantnnccnccnnnnnncncncnnnntcg
nncannncnncgancatggcggcgcgcgggcaggggcaggtgcaagattt
cgacttcttcgtggtggtcgacttcgaggcgacgtgcgtgaaagacggga
ggatcttcccgcaggaaatcatcaagttccccgccgtgctcgtcgacggc
gccaccggccgcatcgagtcggcgtttcgcaggtacgttcgtccaaaaca
tcaccctgtgctgactcaattttgcagggaactcaccggcatccggcagg
aggacgtcgacagcggcgtggatctcggcgaggcgctctggctgcacgag
gcttggctgaagncggcgacggcgggggcagggngcttggccngtcgtga
cctggggagattgggattgccgcaccatgctcgagtcagagtgccgctnc
angngnnnngagaagccntcctacttcgatcgctggnatcaacctgaggn
tccccttccaggcngcgctcggcggngganggcgggtcaccctccaggag
gcggtcagggcagcgggactggactgggagggccgcctgcactgcggnnn
nnnngacgcgcgcaacacggcgcggcttcttgttgagctnatgnngcgcg
gggtcaagatgaccatcaccggntcgctggcgccnncgccgccgatccag
cagnagnagcagccncngcagcttctcacaagcncttgcggtggctcatc
tgngctggcgccgctgccgnngatccagcagaagcagcagtcgccgcnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcttcgcacaagaccttgc
ggtggctcatcggcactggcgccgccgctgatccagcagaagcagcagcc
gccgcagccacacatgataagcccctgcggcggctcctctgcgacgtgct
tctgctactgcagggtaccgaccagaggaggcgtggtgtccgtgccaggg
ccgatgcagggcaagtgcttcttcgggtgtggcaactggacgccggccat
gggacccgtntgcccctacttcgtatggaccaactgaatgaaccacccat
ggcannnnnccagantcagtgtagctcagctgttagtgtaaatcgtgcta
gccatcagaatcagagcttagctcggctgattctagccagtctaggtgtg
aattggtctctggaatcgaatgtanttggtgtctgaattagtantntcan
tngaaantnntttnagtttntnnnnnannnnnannnntntnannnnnnnn
anannnnnnnnannggatgggagtaatatattatcaataagaaattcctt
ttaagtttaaaaaa
BLAST
BLAST Search