Query (optional)   in Class  

GrainGenes Sequence Report: Ta.659.6.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.659.6.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE438259
[ Show all 317 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE443834
BE499799
BE637463
BG606780
BE426127
DNA
gtaacgcacagtgnanncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnngn
nnnnntnnncncnnnnncncnnccnnnntcntcgtctccggnnggccagg
tagttaacagctccagcagccatgggnaaggagaagatccacatcagcat
tgtggtcattggccatgtngactctggcaagtcaaccacgacnggccacc
tcatctacaagcttggaggcattgacaagcgtgtgatngagaggttngag
aaggaagccgctgagatgaacaagaggtctttcaagtatgcctgggtgct
tgacaagctcaaggctgagcgtgagaggggtatcaccatngatattgctc
tgtggaanttcgagaccaccaagtactcnntgcactgtcattgatgctcc
tggtcaccgtgatttcatcaagaacatgatcancngggacctcccaggct
gattgtgctgtgcttatcattgactccaccactggtggttttgaggctgg
tatctccaaggatggccagacccgtgagcangctctccttgcntttcact
cttggtgtgaancagatgatctgctgctgnaacaagatggatgccaccac
tcccaagtactcgaaggcccgttatgaagaaattgtcaaggaagtctctt
catacctgaagaaggtnggttacaaccctgacaaggttcccttngttccc
atctctgggttngagggngacaacatgattgagaggtccaccaaccttga
ctggtacaagggccccacccttctngaggccctggaccagatcaatgagc
ccaagaggccctcngacaagcccctncgtcttccccttcaggacgtntac
aagattggnggcattggaactgtgccagtgggncngtgttgagactggag
tcatcaagccaggcatggttgtcacctttggtcctactggcctgaccact
gaggtgaagtcngtngagatgcaccangagtctctcctggaggcgcttcc
tggtgacaangtcggcttcaacgtcaagaacgtggncngtcaaggatctc
aagcgtgggtacgtcgcttccaactccaaggacgaccctgccaaggaggc
tgccaacttcaccgcccaggtcatcatcatgaaccacccnggnccagatc
agcaacggctatgccccnggtgctggactgccanacgtcccacattgctg
tcaagttngctgagatccagaccaagatngaccggcggtctggcaaggag
attgaggcggcgcccaagttcctnaagaacggtgatgccgggttcgtcaa
gatgatccccaccaagcccatggtggtgganacctttgcccagtaccctc
ccctgggccgntttgctgtgcgnnnacatgaggcagacggttgccgntgg
gngttatcaaggccgtggagaagaaggatccgaccggcgccaaggtgacc
aaggctgcggccaagaagaaatgagatggtgtcaggttctttactgcatc
tatggtggtggtggcggtggcggtatttggtggtggtgatagttgttcta
gtcgttttganaacttgttaagcttcggttatttgtgtcgagcagtgttg
gaactgcttattgctctggtcattgtatcgttcggttgtgttggtggaac
tntgtcagttnatgttgctactanatatagtcgtcatgtttggagtcgtt
ttannnnannnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnntg
BLAST
BLAST Search