Query (optional)   in Class  

GrainGenes Sequence Report: Ta.9188.1.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.9188.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL822697
[ Show all 12 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
cgcacgcggggctcaccggcgacgttgacgtcgcgctcggcacgaaccag
aaccaaaccgaaccctgaaccttaagggctcctttggtttcgcgtggatc
ggaggggatttcggaggattaacctcgcgaggcccaaaatcctcntcgca
aagccccgtcagcccgtttggtacgcgaggttagatggccaaaccccctc
gattccccttcgatccacttctccccacgcggttcagaaccctcgggcgg
gggttcgaggattnggccgcccgacactcgccaagacgccgccgccgact
cctccccaagactacgcgccgctcgacgncggcgatctcctccggcgtac
tggacttctccccggtgnnnnnnnnnnnnnnnnnnnncctgccgcnccga
ttcttgggatccagttgtcacgcctaatttcggttctcaagcaccaaaag
aaggcacaataaacaagccgaatgnataaatttctcccannnnnnnnnnn
nnnnnnnnnnntgacaccaanagatggatacatttgtttgcattatcttt
gttgcaaaatgatgttgtggctgtgatgaactgtttgctgngnaagatta
tgttgttatgataaattatgaatgctgggatttgggattcaaagncatgc
tgttatgataaattangttgttgcnntnannananatngnnntcaagtca
ngcaaaattatgttgnnnttgggaaaacngctgnnaaattatgaganann
gatttcaagtcattttttcaggtcacacatatcaagaaatattgcaaaaa
tgtactaaaaaaaaaaaaaaaaacctgatgaaaataaaaaaaaagtacac
acaggacactagcatcaggctgcatccaaaagatcgggggggcgcggctc
acaagttctccctgagggatgcaggttccccaggaggactggttttcttt
ttt
BLAST
BLAST Search