Query (optional)   in Class  

GrainGenes Sequence Report: Ta.9204.1.S1_s_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.9204.1.S1_s_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE638125
[ Show all 21 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
gatcccagattattccttccctcnnncgaagccgagctcagcaggcgccg
gagcagggacggggacgcccgtcgcaggccgcctcgccgcccgagttgcc
gccgtccggggcccttctcgcctggaggaaaagatggagcctggaaggaa
acctcgtcttctggacctatgcatccggagcgccgtcgacaacctcagga
ccctcaacagcgtggacatcgtggctgaggagctgctcaagagaatcctg
ccccactgcaccttggagcagctgacccacatagagagntgcacacatgc
ggaccttaccgacgttaccgatgtgctgtggaagagattcttccagcgng
agttnggngaggataatatgaacctngccatcaagagnatgaaggagaac
ggngtgcgttacaaatggaagaaactctttgaggcaagaacagaaaagca
aaagcaagttgaagcaagaatgtcggcagggctnaaaaacaaatatcaag
cagcaaacgctgcgaaacaaagcaaacaaattaaagtttgtacnaagatc
ccacccaacagcaaaagaagtttttggggaggaagtggatccagcagcct
atccaactccagctacaagagccctatantnaaaaaggcaaggatggagg
ttgacagccgggcgaaaatgcaagctgctatccaaaggaacacttttgcn
aggtcatcacagccagcaaggctgacctttcctagngaacagacatcnag
gacgacgacaattcatcgacctaattcaacnataaccatcaccaaaccaa
ctggnccnaancaggccgattcaaaagcagaacaccagacccaaatttta
gaggccactgccatgncatcatgcttnnntgaccgnggagttcgccatga
ttgcgcggaaatcttctttcctgtggacaagttggcactncttgccattc
accaagtctttgtgagacaggaaagaatcttgtttgtagntgccccagct
gagcacntgtatctnnntnaggggagcaaacaatatctgnaccnaacatt
ttttnnaaatntnantcaatnaannnnnnnaannnannnnnnnaannnnn
nnnnnaannnnnnnnnnnnnnaaa
BLAST
BLAST Search