Query (optional)   in Class  

GrainGenes Sequence Report: Ta.9535.2.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.9535.2.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE444369
[ Show all 51 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BG262775
BE423133
DNA
nannnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnagcgtggtcgcggccgagnncgac
gaacaccgggacgaagcagatcggcggcgcgtcactccaatcaccggata
aatggcgacggtttcggattctctggtctgggagctcgtcaggaagaaca
actgcttcctgatcaagcagttcggcaacagcaatgccaaggtccagttc
agcaaggagcccaacaacctctacaatgtccactcctacaagtactctgg
cctggcaaacaagaagactgtgacngtgcagccagctgctganaaggaga
tgacngtggtcctctccacaancnangtcaaagaagcagaacaagcctgc
ngcnttcacccacaagactgtcatgcgcaaggagttccgcaagatggcca
aggctntcaagaaccaggtcagtganaactactanaggcctgacttgacc
aagcctgctcttgcaagactgagngcngtttaccgcagcctccaggttgc
caagtccggtgtcaagaagaagaacaggcagtaagcactgaggggccaat
gagcttgttttgtggatccgttggtttatgtttccagctttttagatttg
ttctaaaagtatggaggttgaatatgatgaatggtgtgtgctgcatactg
gcacaagttttctcagtaggttctatatctgtacccannnnctatgttgt
gaagcctcttnaaatcatttccacaattannnnnnnnnnacattnatngt
ntttgctgagttgcttggagttggnantgctnntgatgcgtgtttnnctn
ttanncatgtgctcgntnangtgctaacttannnnnnnnnnggnnnnnng
cgtggnnnnnnnnnntgcaact
BLAST
BLAST Search