Query (optional)   in Class  

GrainGenes Sequence Report: TaAffx.132322.1.S1_at

Sequence
TaAffx.132322.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BE515406
CA611546
CA624127
CK212886
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BF292123
BG313972
DNA
tcgcgggccgcgtcgacctctcctccctctctcacacgcacgcacagaga
agtgaccatgaggaagtccagctgcggccatgtgatcggagtgcctgtga
cctccaaggcgtacgccttagaggaggcgacaaccaggggcgccggggcg
gccaagaaggacggcgatcgcctcgccgtctcgttgacgcacccgagccc
ctacgcgtccttcggctacaaacacagtagcaagggtcaggtgatccatt
gggtgaacaagctgggcagacgggcgcagggcttcagagaccacgtgacc
ctggggccgaagctgtcggagacggtgaaggggaagctcagcctgggcgc
gaggatcctgcaggccggcggcgtggagcgggtgttccggcaggccttct
cggccgagaagggcgagcggctggtgaaggcgctgcagtgctacctctac
accaccagcgggcccatcgccgggatgctcttcgtctccaccaggaagat
cgccttccgcagcgaccgntccctcacngtcacctngcnngcnggcgacg
tcgctcgggtgccgtacaaggtggtggtgccgctggggaggatcaagagg
gtgcagccgagcgagaacgccgacaacccngagcagaagtacatacacat
ggccaccgtggacgggttcgagttctggttcatgggcttcgtnagctacc
agaggtgctgcaagtacatgcagcaggtcatctcgtcccagntgtgatgg
caatagcnnnnntaaaagtgaannngntctngtgggcttcctgccgcaac
gtcttgttggagcgcgngcagccgagaacctctgctccaccattttttng
atgagagcatgttccgatnnnnnnggaatttacagatgtgcctattgcaa
tttctgtttgtaggaccgaggaacttggnctnaatgaanattanttantt
tnnnnggntaaaaaaaaanaaaaaggcggccgctctggngtgtcccttgc
BLAST
BLAST Search