Query (optional)   in Class  

GrainGenes Sequence Report: TaAffx.43576.1.A1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TaAffx.43576.1.A1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
BG606728
BQ168633
BE516546
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
cggagcgccgccgccgcaagcggctcaacgaccgcctctccatgctccgc
tccgtngtgcccaagatcagcaagatggacaggacgtcgatcctggggga
caccatcgactacatgaaggagctgctggagaggatccggcggctgcagg
aggagatggaggagnnnnnnnnnnnccngcatnccggnccngcggcngcn
gcngcngcgccgctgctgagcgtgttccgggagctcaaccccaacgagat
gctcgccnggaacaccccnanntnaggtggagcgcaaggaggagggcgac
acccgggtggaggtctactgcgcggccaagccggggctgctgctgtcgac
ggtgngcacgctcgacacnctnggcctcgacatccagcagtgcgtcgtca
gctgcttcaacgacttcgccatgcacgcctcctgctccgagatgcagagg
gagatgatcagcgcngacgccatcaagcaggagctgttcaagaacgccgg
ctacgggggcggctgcttgtgaggaagnannagcacnnncaccaccatga
gtccatgaccnccannaccancagcagcagcagcangangnnnannaang
nnnannnagntnnannngnnngnnnantnngcagttagcactagcgccag
cagccagcagtagcgaaaaggggctggaagatctgggcggaggcccttta
tcgcaaatcataacaacaatgtcgccgtgatcaaaattctctcctgttag
caacaaagatcggcgggcgcctttccgatgcatgaaatgattgatgaggg
ccgttgtttagtgtttactggccatgttgctgtaccaccaaatcagcccc
caaaagaaagcgaaagcgaaagagaaagcatctnnnnnnnnnnnnnnnnn
nnn
BLAST
BLAST Search