Query (optional)   in Class  

GrainGenes Sequence Report: TaAffx.69777.1.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TaAffx.69777.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
J02961.1
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE500112
BE518087
DNA
caaaggtgcggcgagcagggcagcggcatggagtgccccaacaacctgtg
ctgcagccagtacggctactgcgggatgggcggcgattactgcggcaagg
gctgccagaacggcgcgtgctggaccagcaagcggtgtggcagccaggcc
ggcggcaagacgtgccccaacaaccactgctgcagccagtacgggcactg
cggcttcggcgcggagtactgcggcgccggctgccagggcggcccctgcc
gcgccgacatcaagtgcggcagccaggccggcggcaagctgtgccccaac
aacctctgctgcagccagtgggggtactgcggcctcggttccgagttctg
cggcgagggctgccagaacggcgcttgcagcaccgacaagccgtgtggca
aggacgccggcggcagggtttgcactaacaactactgctgtagcaagtgg
ggatcctgtggcatcggtcccggctactgcggtgcaggctgccagagcgg
cggctgcgatggtgtcttcgccgaggccatcgccaccaactccactcttc
tcgcagaatgatgatcttgctaatggtagtattgcaacgacgcataatcc
gtggcagttccattgccacgtacggttttcccttcacttacttttagtac
tagtacttaataattctctagcttgcaatatgacatgcaggttactgcag
cagaaacaaaatattgctgtagtacatgcatggaaatattaccgagagaa
gtgttgtgtggcaatatagagtgtactataggcgccacaaattagtgttc
ttgttatgacctgctgtcaggatcgatgcatgcatcgctgttgtaatgtt
ggagtacttcgtgatatcgttgcaatatattaccatgagtctcacatc
BLAST
BLAST Search