Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig10208_452

[Submit comment/correction]

Sequence
Tdurum_contig10208_452
Contig
2DS_2984967
Probe
Tdurum_contig10208_452
DNA Homology
2DS_2984967Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442DS_2984967Best IWGSC match
DNA
acgagaagagggttttccatattgtcttgcacatggtaggcactctgata
Matcaatgccgtgcgggctgcctctctttgtatgtgaatagttacaacga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.