Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig10352_373

[Submit comment/correction]

Sequence
Tdurum_contig10352_373
Contig
3B_5659960
Probe
Tdurum_contig10352_373
DNA Homology
3B_5659960Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443B_5659960Best IWGSC match
DNA
acgctgtggatttagcacacaaaggcgtcaagcattctgccagcaacatg
Rtattgtgttatgtccctagttaaatcccatatgttcattatggtgtaac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.