Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig11735_1294

[ Submit comment/correction ]

Sequence
Tdurum_contig11735_1294
Contig
4DL_14457766
Probe
Tdurum_contig11735_1294
DNA Homology
4DL_14457766Best IWGSC match1712e-40URGI_BestIWGSC_N
BLAST, e-value
2e-404DL_14457766Best IWGSC match
DNA
cccggaggtggagcgccacaccctcctcgtcctccgcgactggctgcctt
Mctcctcctccgccgtcttctccgcccagcacgaagccaagaagttcacg
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.