Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig12342_528

[Submit comment/correction]

Sequence
Tdurum_contig12342_528
Contig
2AS_3230294
Species
Triticum aestivum
Probe
Tdurum_contig12342_528
DNA
gagaaggattcaaaggaggaggccagtggatgtctcaaactgttgtcgat
Rgttctgatcaagtgtgctacggatttacattgcactcatccatgaatcg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.