Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig12879_201

[Submit comment/correction]

Sequence
Tdurum_contig12879_201
Contig
2DL_9908867
Species
Triticum aestivum
Probe
Tdurum_contig12879_201
DNA
ataggagacaatcttcatgacacattcgcattatccgttatccgtacgcc
Rcaatcctctgaaagccttttattacacgctcgtctaacctcgagcacca
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.