Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig13957_864

[Submit comment/correction]

Sequence
Tdurum_contig13957_864
Probe
Tdurum_contig13957_864
DNA
acgagcttcatcttggcggcggccgggaagatgcggaggaacggaggcgg
Rcagaatcggaggagctcgagctgtttgctttctcggagcgggagggcaa
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.