Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig17504_244

[Submit comment/correction]

Sequence
Tdurum_contig17504_244
Contig
6BS_3045530
Probe
Tdurum_contig17504_244
DNA Homology
6BS_3045530Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BS_3045530Best IWGSC match
DNA
tgcatctccgatcaaacatcgagtccgccggtgccgaacctcgagttcac
Mctagggaggacacaccattaagtaactagttgaataacagatttctagc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.