Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig27968_156

[Submit comment/correction]

Sequence
Tdurum_contig27968_156
Contig
3AL_4319501
Probe
Tdurum_contig27968_156
DNA Homology
3AL_4319501Best IWGSC match1321e-28URGI_BestIWGSC_N
BLAST, e-value
1e-283AL_4319501Best IWGSC match
DNA
gccggccagctgcccagccactccgacgccttcaccatcaacggcctcac
Mggccagctctaccagtgcgcaaatgagacgttcacggcggtggtgcagc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.