Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig27986_158

[Submit comment/correction]

Sequence
Tdurum_contig27986_158
Contig
6BL_4303645
Probe
Tdurum_contig27986_158
DNA Homology
6BL_4303645Best IWGSC match1503e-34URGI_BestIWGSC_N
BLAST, e-value
3e-346BL_4303645Best IWGSC match
DNA
agccggtgccaccccggtggccatggcgatgactatgcccaagcttcgaa
Rgctcgcctacgcacgcaatcctacaaacacctcgcagctccgtccggcg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.