Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig28802_213

[Submit comment/correction]

Sequence
Tdurum_contig28802_213
Contig
6AL_5830742
Probe
Tdurum_contig28802_213
DNA Homology
6AL_5830742Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5830742Best IWGSC match
DNA
tggaaggaacttccattccgtggcccgctggttgctgcaatccctcaagg
Ragtgcaaggattaatcctgttaatgggcagcaaaatggcggccacatga
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.