Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig31514_449

[Submit comment/correction]

Sequence
Tdurum_contig31514_449
Contig
4DS_1413531
Probe
Tdurum_contig31514_449
DNA Homology
4DS_1413531Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444DS_1413531Best IWGSC match
DNA
tcgacaaactggacaatgcaataggacagctgctggtggtagattccgac
Rgacttgggcttgtgcagcgggatgagcgcgcggctgaggaacagcttgt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.