Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig34093_101

Sequence
Tdurum_contig34093_101
Contig
1AL_1004132
Species
Triticum aestivum
Probe
Tdurum_contig34093_101
DNA
CGGTCAGATCCGGTGCTTGCGAGAGGACTACGCCCACCGCTCCTCCTCCA
Kgcgcctctcgacgccatactgcgcatcatcgaccaggaccctggccgcc
g
BLAST
BLAST Search