Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig42095_2454

[Submit comment/correction]

Sequence
Tdurum_contig42095_2454
Contig
2AL_6410176
Probe
Tdurum_contig42095_2454
DNA Homology
2AL_6410176Best IWGSC match1321e-28URGI_BestIWGSC_N
BLAST, e-value
1e-282AL_6410176Best IWGSC match
DNA
atatatagcaggcggtacttgttacgacgaagtgctttggaattatttat
Rgtagataggtcaaatttcttttttgatttcggggatatggaagcacgca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.