Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig42421_552

[Submit comment/correction]

Sequence
Tdurum_contig42421_552
Contig
5AS_1508214
Probe
Tdurum_contig42421_552
DNA Homology
5AS_1508214Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AS_1508214Best IWGSC match
DNA
attcttaccaatttctttccttcacgtgcaacaaaagagcagtttattca
Ragaaaaaaattaatggaggcacgaaaatggtaatttctcattcaaacat
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.