Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig44809_1626

[Submit comment/correction]

Sequence
Tdurum_contig44809_1626
Contig
1AS_3287754
Species
Triticum aestivum
Probe
Tdurum_contig44809_1626
DNA
agatgcacgacaagatgaagcatgttccagggctccgtgcctagctagca
Ragagcggcagagacgcagaacatgatgaagcatgttccagagctctgtg
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.