Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig47101_301

[Submit comment/correction]

Sequence
Tdurum_contig47101_301
Probe
Tdurum_contig47101_301
DNA
agttcagcaacttcttctagcatcgtgtcgtgtgtgctcggtccgtccac
Rtcgtgcagcttctgaaggcagtcacacacacccgttgcctcatattgcg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.