Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig4795_404

[Submit comment/correction]

Sequence
Tdurum_contig4795_404
Contig
4BL_6968621
Probe
Tdurum_contig4795_404
DNA Homology
4BL_6968621Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444BL_6968621Best IWGSC match
DNA
gatgcaaggacattggtgttacaacagctcttggtattcgagggagaaac
Rgctcttgacaagatgattacagtggtgacacattcgtcaaatcatcgag
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.