Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig49608_1323

[Submit comment/correction]

Sequence
Tdurum_contig49608_1323
Contig
4BS_4959033
Probe
Tdurum_contig49608_1323
DNA Homology
4BS_4959033Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-424BS_4959033Best IWGSC match
DNA
tgggttaaggacggcaagtgcgtgggcgcgttcctggagggcgggtcgcc
Rgacgagaacgccgccatcgccaagctcgcgagggcccagctgcccgccg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.