Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig4964_569

[Submit comment/correction]

Sequence
Tdurum_contig4964_569
Contig
6AS_4350882
Probe
Tdurum_contig4964_569
DNA Homology
6AS_4350882Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AS_4350882Best IWGSC match
DNA
tctagggactgaaatgttgatgtctgcaaagcaaacggagagagccgacc
Rtaaccaatagaacatggagcatatgggagacgaaatttgcttgccgcgg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.