Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig51627_1211

[Submit comment/correction]

Sequence
Tdurum_contig51627_1211
Contig
6DL_3219530
Probe
Tdurum_contig51627_1211
DNA Homology
6DL_3219530Best IWGSC match1212e-25URGI_BestIWGSC_N
BLAST, e-value
2e-256DL_3219530Best IWGSC match
DNA
tgatctcatcaccagtggcaataagattttgtctgataggagaggttcag
Magtgtatttagaaagtggaggaggactaatcaattgcatgcccagtgga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.