Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig58669_273

[Submit comment/correction]

Sequence
Tdurum_contig58669_273
Contig
5BL_10917461
Probe
Tdurum_contig58669_273
DNA Homology
5BL_10917461Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10917461Best IWGSC match
DNA
atcacagcgcacacaagctaagcatatcgtacagacaccgcacatgaaca
Mcccctgttgctgctgcccacgcagttggcagtggtcacacgaatcgggt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.