Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig60052_184

[Submit comment/correction]

Sequence
Tdurum_contig60052_184
Contig
5BL_2467905
Probe
Tdurum_contig60052_184
DNA Homology
5BL_2467905Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_2467905Best IWGSC match
DNA
ttgaaagacaatatcatcaacctacatgctattcttttctaatacatgtt
Raatttattaacatatgaccaagggcatctttaaggctccttgcagcaaa
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.