Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig61324_305

[Submit comment/correction]

Sequence
Tdurum_contig61324_305
Contig
1BS_3442815
Probe
Tdurum_contig61324_305
DNA Homology
1BS_3442815Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441BS_3442815Best IWGSC match
DNA
agatgctactgcagagtctggagtctcccgcgggcgtttcaggaggcctc
Rgcggtggagaaatgcatcttagcagccgtctcgagcaggaagctgcttc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.