Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig64467_233

[Submit comment/correction]

Sequence
Tdurum_contig64467_233
Contig
6BS_96655
Probe
Tdurum_contig64467_233
DNA Homology
6BS_96655Best IWGSC match1412e-31URGI_BestIWGSC_N
BLAST, e-value
2e-316BS_96655Best IWGSC match
DNA
gccttgttgaatgtgtccacatatctggaccggacacccgttcgtccacg
Mgcggaaaactggttctggctgggcggaattggcggcatccccaaaccat
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.