Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig68258_2418

[Submit comment/correction]

Sequence
Tdurum_contig68258_2418
Contig
6AL_5823017
Probe
Tdurum_contig68258_2418
DNA Homology
6AL_5823017Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5823017Best IWGSC match
DNA
tatgactggcatgatacaacgtatgtaaacttcatgtcggctacagcttt
Rgactgagttaataagtgtgattcctcagatagtatatctgcagccctga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.