Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig75644_871

[Submit comment/correction]

Sequence
Tdurum_contig75644_871
Contig
7BS_3161461
Probe
Tdurum_contig75644_871
DNA Homology
7BS_3161461Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BS_3161461Best IWGSC match
DNA
gcatgagtggtaagattgctatgtgataaccacttgatgctgtttcggat
Rattatagaattgtatgagcaaacctgttgtccgggttaaaaacatttac
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.