Query (optional)   in Class  

GrainGenes Sequence Report: Tdurum_contig76266_399

[Submit comment/correction]

Sequence
Tdurum_contig76266_399
Contig
1BS_3483212
Species
Triticum aestivum
Probe
Tdurum_contig76266_399
DNA
cagtttccctcgccgtcgatgagctttaactccacagagtggaagggtat
Ragagcaggcctttgtgacgaagtgatcacagttatgcccatgtttgttg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.